View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1748_high_14 (Length: 288)

Name: NF1748_high_14
Description: NF1748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1748_high_14
NF1748_high_14
[»] chr2 (2 HSPs)
chr2 (141-190)||(12678205-12678254)
chr2 (202-253)||(12678238-12678289)


Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 12678205 - 12678254
Alignment:
Q  141 cttgcaaatgcacgtctatatatttgtaatcaatttactatgattattgt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12678205 cttgcaaatgcacgtctatatatttgtaatcaatttactatgattattgt 12678254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 202 - 253
Target Start/End: Original strand, 12678238 - 12678289
Alignment:
Q  202 tttactatgattattgtcatgcattcttttgtccggtgttgtttttcttcac 253  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  12678238 tttactatgattattgttatgcattcttttgtccggtgttgtttttcttcac 12678289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University