View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17488_low_18 (Length: 245)

Name: NF17488_low_18
Description: NF17488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17488_low_18
NF17488_low_18
[»] chr5 (1 HSPs)
chr5 (3-127)||(19558998-19559122)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 3 - 127
Target Start/End: Original strand, 19558998 - 19559122
Alignment:
Q  3 actgaaccaggctacttcaaaagatgacactaaagaatatttatcagaaatgatatttttgacaacacaaatgttgccatgacaccatataatgacaatg 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19558998 actgaaccaggctacttcaaaagatgacactaaagaatatttatcagaaatgatatttttgacaacacaaatgttgccatgacaccatataatgacaatg 19559097  T
Q  103 ttgtgggtttttctattgaactttc 127  Q
    |||||||||||||||||||||||||    
T  19559098 ttgtgggtttttctattgaactttc 19559122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University