View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17488_high_16 (Length: 248)

Name: NF17488_high_16
Description: NF17488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17488_high_16
NF17488_high_16
[»] chr1 (1 HSPs)
chr1 (19-233)||(46210106-46210320)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 46210106 - 46210320
Alignment:
Q  19 accctattagttatggctttactctagccctacccttttagtataatttaacttttctttaggtgatccataacttcaattatgtctccatacctcgatc 118  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  46210106 accctactagttgtggctttactctagccctacccttttagtataatttaacttttctttaggtgattcataacttcaattatgtctccatacctcgatc 46210205  T
Q  119 ctctaatcgttatatttagtatatatttgaattgaaggttgaattgtccgtgattatgacaaaatttacacttcatagtttcaataaagttcgccgctca 218  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46210206 ctctaatcgttatatttagtgtatatttgaattgaaggttgaattgtctgtgattatgacaaaatttacacttcatagtttcaataaagttcgccgctca 46210305  T
Q  219 tctaaacatacacct 233  Q
    |||||||||||||||    
T  46210306 tctaaacatacacct 46210320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University