View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17487_high_21 (Length: 302)

Name: NF17487_high_21
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17487_high_21
NF17487_high_21
[»] chr8 (1 HSPs)
chr8 (166-285)||(24942002-24942118)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 166 - 285
Target Start/End: Original strand, 24942002 - 24942118
Alignment:
Q  166 aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt 265  Q
    |||||||||||||||   ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||    
T  24942002 aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt 24942098  T
Q  266 gttctattagttacatgttg 285  Q
    ||||||||||||||||||||    
T  24942099 gttctattagttacatgttg 24942118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University