View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17474_low_38 (Length: 254)

Name: NF17474_low_38
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17474_low_38
NF17474_low_38
[»] chr3 (1 HSPs)
chr3 (13-233)||(52179790-52180010)


Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 52180010 - 52179790
Alignment:
Q  13 cgaagaatattgttagggagatcaatgacatggagagattatgaattgctgggaatggacctaaaggtacagggcgcagtctccgacatagtttaaggat 112  Q
    |||| ||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  52180010 cgaaaaatattgttagggagattaatgacatggagagactatgaattgctggtaatggacctaaaggtacagggcgcagtctccgacatagtttaaggat 52179911  T
Q  113 gacgtggatagttaccgtgatggagatgtaaaagaatatggcggagatgagaaaccaccatgtggctccccatgatagggcaggactccaccggaatgaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52179910 gacgtggatagttaccgtgatggagatgtaaaagaatatggcggagatgagaaaccaccatgtggctccccatgatagggcaggactccaccggaatgaa 52179811  T
Q  213 acaattgatgggtgatctagt 233  Q
    |||||||||||||||||||||    
T  52179810 acaattgatgggtgatctagt 52179790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University