View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17473_high_14 (Length: 425)

Name: NF17473_high_14
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17473_high_14
NF17473_high_14
[»] chr3 (2 HSPs)
chr3 (178-271)||(24496941-24497034)
chr3 (329-364)||(24496902-24496937)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 178 - 271
Target Start/End: Complemental strand, 24497034 - 24496941
Alignment:
Q  178 ttaatgtcactctttatgtttctgccttgcaatgaattatggtgatattatatgaattttttgttatgttgatctgtatttgataactattgaa 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  24497034 ttaatgtcactctttatgtttctgccttgcaatgaattatggtgatattatatgtattttttgttatgttgatctgtatttgataactattgaa 24496941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 329 - 364
Target Start/End: Original strand, 24496902 - 24496937
Alignment:
Q  329 tgagaaactagaaattgagaattcaattcaatgcca 364  Q
    ||||||||||||||||||||||||||||||||||||    
T  24496902 tgagaaactagaaattgagaattcaattcaatgcca 24496937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University