View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17468_low_36 (Length: 228)

Name: NF17468_low_36
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17468_low_36
NF17468_low_36
[»] chr4 (2 HSPs)
chr4 (13-114)||(36743923-36744019)
chr4 (172-214)||(36743464-36743506)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 114
Target Start/End: Complemental strand, 36744019 - 36743923
Alignment:
Q  13 ataattctcgcaagtctttctttgatagaagcaagcatattagaacttggtgtctattattagaagaatgacaagtctcatgagatttcgccactttatc 112  Q
    ||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||    
T  36744019 ataattctcgcaagtctt-----gatagaagcaagcatattagaacttggtgtctattattagaagaatgacaagtctgatgagatttcgccacgttatc 36743925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 36743506 - 36743464
Alignment:
Q  172 atgaatttgaaaatcaaatccaaacaaattaatcaaacttttt 214  Q
    |||||||||||||||||||||||||||||||||||||| ||||    
T  36743506 atgaatttgaaaatcaaatccaaacaaattaatcaaacatttt 36743464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University