View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17468_high_36 (Length: 213)

Name: NF17468_high_36
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17468_high_36
NF17468_high_36
[»] chr1 (1 HSPs)
chr1 (1-201)||(37950638-37950838)
[»] chr5 (1 HSPs)
chr5 (2-58)||(10766193-10766249)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 37950638 - 37950838
Alignment:
Q  1 gttgtagaaggtcatttgcagaggtctaccggtggatccttattttttggatccatatcagggctccccttttacaagtatgaggatgaggataagttga 100  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||    
T  37950638 gttgtagaaggtcatttgcataggtctaccggtggatccttattttttggatccatatcagggctccccttttacaagcatgaggatgaggacaagttga 37950737  T
Q  101 gttgagtggctcacgatgttctactgtttcttcttcttgacatccaaaaccgtaaatgacaattgtgtgggtctttgttgagggtttatggtggtggatg 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37950738 gttgagtggctcacgatgttctactgtttcttcttctcgacatccaaaaccgtaaatgacaattgtgtgggtctttgttgagggtttatggtggtggatg 37950837  T
Q  201 a 201  Q
    |    
T  37950838 a 37950838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 10766249 - 10766193
Alignment:
Q  2 ttgtagaaggtcatttgcagaggtctaccggtggatccttattttttggatccatat 58  Q
    ||||||||||||||||||| ||||| |||  | || ||||||||||||| |||||||    
T  10766249 ttgtagaaggtcatttgcataggtccaccaatagacccttattttttggttccatat 10766193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University