View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17464_high_32 (Length: 251)

Name: NF17464_high_32
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17464_high_32
NF17464_high_32
[»] chr2 (1 HSPs)
chr2 (11-232)||(4284245-4284466)


Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 4284466 - 4284245
Alignment:
Q  11 cacagacgctacgctctaatagaaggagcgtgaagtaaaagggttttggagtttccagattaggataaaagcaagatgcagcggtttaaccggttatgca 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4284466 cacagacgctacgctctaatagaaggagcgtgaagtaaaagggttttggagtttccagattaggataaaagcaagatgcagcggtttaaccggttatgca 4284367  T
Q  111 gtgaatggtaccccgttatgtccgggttattcaactaagggtagggtagggcccacagttcacaaccacatagttggagggtagtagtaagtagggtact 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4284366 gtgaatggtaccccgttatgtccgggttattcaactaagggtagggtagggcccacagttcacaaccacatagttggagggtagtagtaagtagggtact 4284267  T
Q  211 gtacttcactgactgagcccta 232  Q
     |||||||||||||||||||||    
T  4284266 atacttcactgactgagcccta 4284245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University