View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17462_high_16 (Length: 230)

Name: NF17462_high_16
Description: NF17462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17462_high_16
NF17462_high_16
[»] chr6 (1 HSPs)
chr6 (55-214)||(1217343-1217506)


Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 55 - 214
Target Start/End: Complemental strand, 1217506 - 1217343
Alignment:
Q  55 ataggccaccaccgttcttgattagtctgttttcagaataaataggaattctatcataatgatcaccaccactcgtcatgacaggcattaataactccct 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1217506 ataggccaccaccgttcttgattagtctgttttcagaataaataggaattctatcataatgatcaccaccactcgtcatgacaggcattaataactccct 1217407  T
Q  155 aaaaatattgtcataaaa----atattaccccatcaccagatatattagccacttggacaataa 214  Q
    ||||||||||||||||||    |||||||||||||||||||||||| |||||||||||||||||    
T  1217406 aaaaatattgtcataaaaatatatattaccccatcaccagatatatcagccacttggacaataa 1217343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University