View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17458_low_15 (Length: 227)

Name: NF17458_low_15
Description: NF17458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17458_low_15
NF17458_low_15
[»] chr3 (1 HSPs)
chr3 (1-222)||(2115988-2116208)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2116208 - 2115988
Alignment:
Q  1 ccttgcagcaaataatggtacctttgaaagacctatataccctaccctatgaatttatttttgacctacataaaaattagaggaaattttcttttattag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||    
T  2116208 ccttgcagcaaataatggtacctttgaaagacctatataccctaccctatgaatttatttttgacctacataaaaattagaggaagtttttttttattag 2116109  T
Q  101 gtgtaaactagcggcgcattatgcatcaaccacttgcgctagacctagtaattcattagaggttattgctaattactaattaaaagaaacagattttgct 200  Q
    |||||||||| |||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  2116108 gtgtaaactaccggcacattatgcatcaaccacttgcaccagacctagtaattcattagaggttattgctaattactaatt-aaagaaacagattttgct 2116010  T
Q  201 tagagcaatctttgaggaggtt 222  Q
    || ||| |||||||||||||||    
T  2116009 taaagcgatctttgaggaggtt 2115988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University