View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17457_low_10 (Length: 229)

Name: NF17457_low_10
Description: NF17457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17457_low_10
NF17457_low_10
[»] chr2 (1 HSPs)
chr2 (21-180)||(6667272-6667430)
[»] chr3 (1 HSPs)
chr3 (77-178)||(32135769-32135869)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 21 - 180
Target Start/End: Original strand, 6667272 - 6667430
Alignment:
Q  21 gttacaaaaggacttgattaaaataaaaataaattaaaccatattaattggcttactcggttgccttttacaaaattttaaattaacaaccacctgaaac 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||  ||    
T  6667272 gttacaaaaggacttgattaaaataaaaataaattaaaccatattaattggcttactcggttgccttttgcaaaattttaaattaacatccacctg-gac 6667370  T
Q  121 caatggcagcgaaggtgtccaagggagagtgttaaagcaactgtgcttagcattcctctt 180  Q
    |||||||| ||||| ||||||||||||||||||||||||||||| |||| ||||| ||||    
T  6667371 caatggcaacgaagatgtccaagggagagtgttaaagcaactgttcttaacattcttctt 6667430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 77 - 178
Target Start/End: Complemental strand, 32135869 - 32135769
Alignment:
Q  77 tcggttgccttttacaaaattttaaattaacaaccacctgaaaccaatggcagcgaaggtgtccaagggagagtgttaaagcaactgtgcttagcattcc 176  Q
    |||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||  |||||||||||||    
T  32135869 tcggttgccttttacaaaattttaaattaacaaccacctgga-ccaatggcagcggaggtgtccaagggagagtgttaaagcaaccatgcttagcattcc 32135771  T
Q  177 tc 178  Q
    ||    
T  32135770 tc 32135769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University