View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17453_low_30 (Length: 257)

Name: NF17453_low_30
Description: NF17453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17453_low_30
NF17453_low_30
[»] chr5 (1 HSPs)
chr5 (11-241)||(515594-515824)


Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 515824 - 515594
Alignment:
Q  11 caagaatatcatacgaaatgaaaactccattacaattttcagctgacggagggagagcctcaggttcttgacattcacacacatacacattgtatgaaat 110  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  515824 caagaaaatcatacgaaatgaaaactccattacaattttcagctgacggagggagagcctcaggttcttgacattcacacacatagacattgtatgaaat 515725  T
Q  111 caacaatgttgctaatgataacaattgacatatccatttgtttgacatgtcttattattattctattgtcaatctctctcgcatttgcatgatggaatat 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  515724 caacaatgttgctaatgataacaattgacatatccatttgtttgacatgtcttattattatcctattgtcaatctctctcgcatttgcatgatggaatat 515625  T
Q  211 gagaaattgttgtaatgatcgagcttctaga 241  Q
    |||||||||||||||||||||||||||||||    
T  515624 gagaaattgttgtaatgatcgagcttctaga 515594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University