View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17452_low_94 (Length: 214)

Name: NF17452_low_94
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17452_low_94
NF17452_low_94
[»] scaffold0024 (1 HSPs)
scaffold0024 (16-194)||(13926-14104)
[»] chr3 (1 HSPs)
chr3 (121-168)||(43010780-43010827)


Alignment Details
Target: scaffold0024 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 14104 - 13926
Alignment:
Q  16 atgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcggcagaaggtatgggaaatagtcgcagcaggccattttgaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||    
T  14104 atgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcagcagaaggtatgggaaatagtcgcagcagaccattttgaa 14005  T
Q  116 tcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagat 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14004 tcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagat 13926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 168
Target Start/End: Original strand, 43010780 - 43010827
Alignment:
Q  121 tctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatgg 168  Q
    ||||| |||||||||||||||||||||| ||||||| |||||||||||    
T  43010780 tctctgatgatgtgacaatctatttcaacgtgtttaatacgttcatgg 43010827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University