View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17445_low_36 (Length: 254)

Name: NF17445_low_36
Description: NF17445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17445_low_36
NF17445_low_36
[»] chr2 (2 HSPs)
chr2 (1-93)||(42788174-42788266)
chr2 (116-184)||(42788292-42788360)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 42788174 - 42788266
Alignment:
Q  1 ctacaaacataattatccttaatggtttcactgtcaaaaactttttgcgcaataggttcaagttgattcactaaatgactattattgtcatag 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||    
T  42788174 ctacaaacataattatccttaatggtttcactgtcaaaaactttttgcacaataggttcaagttgattcactaaatgactattactgtcatag 42788266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 42788292 - 42788360
Alignment:
Q  116 atgtatatgtatttggaatattgataaagttctgatcaacaatattatagttttgggttgcagcatcac 184  Q
    |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||    
T  42788292 atgtatttgtatttggaatattgataaaattctgatcaacaatattatagttttgggtggcagcatcac 42788360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University