View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17442_low_28 (Length: 247)

Name: NF17442_low_28
Description: NF17442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17442_low_28
NF17442_low_28
[»] chr3 (3 HSPs)
chr3 (3-206)||(17944764-17944965)
chr3 (3-94)||(19416571-19416661)
chr3 (28-94)||(19403393-19403458)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 3 - 206
Target Start/End: Original strand, 17944764 - 17944965
Alignment:
Q  3 agaacttacttcaatatannnnnnngatatcctgtcaaagataaattatctactctaacttacatgtctggggaagaggaagaaaatactgcaaagctca 102  Q
    ||||||||||||||||||       ||||| ||||||||||| ||||||| || |||||||| ||||| | |||||||||||||||||||||||||||||    
T  17944764 agaacttacttcaatatatttttttgatat-ctgtcaaagat-aattatcaacactaacttatatgtccgaggaagaggaagaaaatactgcaaagctca 17944861  T
Q  103 aaatcggagatggtaatcttctactccagaaatgctttgattaaaatcttcctcgtctttccctttctcgattcaacatggtaaccttctttcgtaaact 202  Q
    |||||||||||||||||||||||||||||||| |||||||  |||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||     
T  17944862 aaatcggagatggtaatcttctactccagaaacgctttgaagaaaatcatcctcgtctttccctctctcgattcaacatggtaaccttctttcgaaaaca 17944961  T
Q  203 ttct 206  Q
    ||||    
T  17944962 ttct 17944965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 3 - 94
Target Start/End: Original strand, 19416571 - 19416661
Alignment:
Q  3 agaacttacttcaatatannnnnnngatatcctgtcaaagataaattatctactctaacttacatgtctggggaagaggaagaaaatactgc 94  Q
    ||||||||||||||||||       ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
T  19416571 agaacttacttcaatatatttttttgatatcctgtcaaagataa-ttatctacactaacttacatgtctggggaagaggaagaaaatactgc 19416661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 94
Target Start/End: Original strand, 19403393 - 19403458
Alignment:
Q  28 gatatcctgtcaaagataaattatctactctaacttacatgtctggggaagaggaagaaaatactgc 94  Q
    ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
T  19403393 gatatcctgtcaaagataa-ttatctacactaacttacatgtctggggaagaggaagaaaatactgc 19403458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University