View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17437_low_25 (Length: 208)

Name: NF17437_low_25
Description: NF17437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17437_low_25
NF17437_low_25
[»] chr4 (1 HSPs)
chr4 (26-208)||(49252682-49252864)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 26 - 208
Target Start/End: Original strand, 49252682 - 49252864
Alignment:
Q  26 tgtgcaagttatttaatggggtttgggaaatttctataccctatactatatccataaattgtgaaagaaaagagttaattatttgatgaatgggcggttt 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  49252682 tgtgcaagttatttaatggggtttgggaaatttctataccctatactgtatccataaattgtgaaagaaaagagttaattatttgatgaatgggcagttt 49252781  T
Q  126 tttctacttgagtgttttagatcttccactggaattagttgtctgttttagtttccaatgcagataacatggttcagcaaaac 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49252782 tttctacttgagtgttttagatcttccactggaattagttgtctgttttagtttccaatgcagataacatggttcagcaaaac 49252864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University