View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17436_low_8 (Length: 259)

Name: NF17436_low_8
Description: NF17436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17436_low_8
NF17436_low_8
[»] chr8 (3 HSPs)
chr8 (1-166)||(9335586-9335751)
chr8 (200-240)||(9336150-9336190)
chr8 (163-193)||(9336026-9336056)


Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 9335586 - 9335751
Alignment:
Q  1 ataaatcaaatgaaccatatgatttaaatatgcaaatgatccagtcagtagcggtcactagaggccaatatgaaatacaatgtacgggtttttgcaaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||    
T  9335586 ataaatcaaatgaaccatatgatttaaatatgcaaatgatccattcagtagcggtcaccagaggccaatatgaaatacaatgtacaggtttttgcaaaaa 9335685  T
Q  101 cctgccacaagggccagtaactcaattcagtcatatggaaacataaatgatgaatgaaatcctcaa 166  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9335686 cctgctacaagggccagtaactcaattcagtcatatggaaacataaatgatgaatgaaatcctcaa 9335751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 240
Target Start/End: Original strand, 9336150 - 9336190
Alignment:
Q  200 aagtagaaatcaagtattaaattattatcacctccccgcat 240  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  9336150 aagtagaaatcaagtattaaattattatcacctccccgcat 9336190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 193
Target Start/End: Original strand, 9336026 - 9336056
Alignment:
Q  163 tcaaattcactcaaataaaaaatgttaaata 193  Q
    |||||||||||||||||||||||||||||||    
T  9336026 tcaaattcactcaaataaaaaatgttaaata 9336056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University