View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17434_low_47 (Length: 272)

Name: NF17434_low_47
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17434_low_47
NF17434_low_47
[»] chr3 (1 HSPs)
chr3 (18-262)||(52036155-52036411)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 52036411 - 52036155
Alignment:
Q  18 ggtagttgggaggaggacgacgaagaagctttaggccgcggtttctctgctagatatgctgcaccttcagctaaaacactcaagcaatgatataattttt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||  |||    
T  52036411 ggtagttgggaggaggacgacgaagaagctttaggccgcggtttctctgctagatatgctgcatcttcagctaaaacactcaagcaatgatataaggttt 52036312  T
Q  118 atagaagtgttttcggagataacatggttttaaattacgg----------ttgctatatcttgagac--nnnnnnnngtagttaaaataatcatatggtt 205  Q
    ||||||||||||||||||||||||||||||| ||||||||          |||||||||||||||||          |||||||||||||||||||||||    
T  52036311 atagaagtgttttcggagataacatggttttcaattacggttcataccttttgctatatcttgagacttttttttttgtagttaaaataatcatatggtt 52036212  T
Q  206 gtagaaattattcatgtttgatgcatcgatggttgtattaatctgaacctgtgtata 262  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  52036211 gtagaaattattcatgtttgatgcatcaatggttgtattaatctgaacctgtgtata 52036155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University