View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17434_low_37 (Length: 312)

Name: NF17434_low_37
Description: NF17434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17434_low_37
NF17434_low_37
[»] chr4 (2 HSPs)
chr4 (20-127)||(47654280-47654387)
chr4 (192-305)||(47654172-47654285)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 20 - 127
Target Start/End: Complemental strand, 47654387 - 47654280
Alignment:
Q  20 aaaatgtcattttgttgaagtttttggcgcatataaagtttttcatattgatttgcgttgaacatggttcataggtacgcacaagtgggtagggatggtt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47654387 aaaatgtcattttgttgaagtttttggcgcatataaagtttttcatattgatttgcgttgaacatggttcataggtacgcacaagtgggtagggatggtt 47654288  T
Q  120 cgtacacg 127  Q
    ||||||||    
T  47654287 cgtacacg 47654280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 192 - 305
Target Start/End: Complemental strand, 47654285 - 47654172
Alignment:
Q  192 tacacaattatacgggcacaattgaccgaattttattaccaaacttcgtttatctatcgtttacggttgccgtttaagtttcctttcataattggttgtt 291  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| || |||||||||||||||||||    
T  47654285 tacacgattatacgggcacaattgaccgaattttattaccaaactttgtttatctattgtttacggttgccgtttaatttccctttcataattggttgtt 47654186  T
Q  292 gttctaacagttta 305  Q
    ||||||||||||||    
T  47654185 gttctaacagttta 47654172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University