View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17432_low_38 (Length: 202)

Name: NF17432_low_38
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17432_low_38
NF17432_low_38
[»] chr8 (1 HSPs)
chr8 (19-188)||(39955565-39955734)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 9e-72; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 39955734 - 39955565
Alignment:
Q  19 aatcatttatcaagtttttatttatgtccagaccaaattgtatattatcaaggtctcttttttctaaaaaccggagttaaaattgggataagtattttta 118  Q
    |||||||||||||  ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39955734 aatcatttatcaaagttttatttatgtccagaccaaattgcatattatcaaggtctcttttttctaaaaaccggagttaaaattgggataagtattttta 39955635  T
Q  119 ataagggaaataaatatttaatgcatgctttcttcaatttatttacnnnnnnnattaagtaattatgaaa 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||    
T  39955634 ataagggaaataaatatttaatgcatgctttcttcaatttatttactttttttattaagtaattatgaaa 39955565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University