View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17432_high_22 (Length: 278)

Name: NF17432_high_22
Description: NF17432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17432_high_22
NF17432_high_22
[»] chr3 (1 HSPs)
chr3 (13-261)||(54543647-54543894)


Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 54543647 - 54543894
Alignment:
Q  13 aaaatacgcggtagatacacaccagtcagggagtggtaggccagcaaggtttgaatgttgcatccagacatttgctaagttgaagaaataaaagaacaca 112  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  54543647 aaaatacgcgggagatacacaccagtcagggagtggtaggccagcaaggtttgaatgttgcatccagacatttgc-aagttgaagaaataaaagaacaca 54543745  T
Q  113 aactgataagacgagaaatggaagagtacagtttcagannnnnnnggaacgtggttatataattaagtaaggtatgctgatagttttgcattggaaacag 212  Q
    ||||||||||| ||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54543746 aactgataagaagagaaatggaagagtacagtttcagatttttttggaacgtggttatataattaagtaaggtatgctgatagttttgcattggaaacag 54543845  T
Q  213 ctgataattattaagtagaggagaggacatgagaagagaaagagaaaga 261  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||    
T  54543846 ctgataattattaagtagtggagaggacatgagaagagaaagagaaaga 54543894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University