View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17431_high_16 (Length: 228)

Name: NF17431_high_16
Description: NF17431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17431_high_16
NF17431_high_16
[»] chr3 (1 HSPs)
chr3 (25-150)||(24259365-24259490)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 25 - 150
Target Start/End: Original strand, 24259365 - 24259490
Alignment:
Q  25 gtggggttgtgttggttgattgatgaaaaattgagacagcccacatggctaaatagatttgaatatgttgtaacatgttttgtatattataaagtttggt 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  24259365 gtggggttgtgttggttgattgatgaaaaattgagacagcccacatggctgaatagatttgaatatgttgtaacatgttttgtatattataaagtttggt 24259464  T
Q  125 tttttgcaagacaattggatttgaga 150  Q
    ||| ||||||||||||||||||||||    
T  24259465 tttatgcaagacaattggatttgaga 24259490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University