View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17424_low_26 (Length: 245)

Name: NF17424_low_26
Description: NF17424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17424_low_26
NF17424_low_26
[»] chr3 (1 HSPs)
chr3 (64-201)||(1573702-1573839)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 64 - 201
Target Start/End: Complemental strand, 1573839 - 1573702
Alignment:
Q  64 aacctgtgttgcttgagtaatgttcaatggaacaatagagccaggtgtaacaactacttctgcatattcatcactactcagtcttaagctttctacttct 163  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1573839 aacctgtgttgcttgagtaatgttcaatggaacaacagagccaggtgtaacaactacttctgcatattcatcactactcagtcttaagctttctacttct 1573740  T
Q  164 tctactggccattgaagcaaattagttccagtcttctg 201  Q
    ||||||||||||||||||||||||||||||||||||||    
T  1573739 tctactggccattgaagcaaattagttccagtcttctg 1573702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University