View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17418_low_4 (Length: 418)

Name: NF17418_low_4
Description: NF17418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17418_low_4
NF17418_low_4
[»] chr1 (9 HSPs)
chr1 (200-413)||(34655003-34655216)
chr1 (222-413)||(39708905-39709095)
chr1 (207-346)||(34118087-34118228)
chr1 (207-343)||(615823-615956)
chr1 (30-96)||(34655326-34655392)
chr1 (333-398)||(34118012-34118077)
chr1 (284-346)||(11407929-11407992)
chr1 (287-413)||(26236622-26236749)
chr1 (111-146)||(34655271-34655306)
[»] chr5 (10 HSPs)
chr5 (207-408)||(41355414-41355615)
chr5 (216-346)||(7766882-7767012)
chr5 (207-346)||(27169956-27170096)
chr5 (216-347)||(18697047-18697180)
chr5 (207-342)||(7271893-7272025)
chr5 (207-343)||(6030258-6030391)
chr5 (333-413)||(7767022-7767102)
chr5 (333-413)||(18696958-18697038)
chr5 (226-343)||(26656827-26656941)
chr5 (226-343)||(26928414-26928528)
[»] chr4 (9 HSPs)
chr4 (201-347)||(23054096-23054242)
chr4 (207-340)||(53202387-53202520)
chr4 (207-347)||(47518319-47518459)
chr4 (333-398)||(47518468-47518533)
chr4 (333-397)||(53202307-53202371)
chr4 (289-346)||(6410106-6410164)
chr4 (341-403)||(23054258-23054320)
chr4 (284-342)||(24957550-24957609)
chr4 (332-413)||(6410016-6410097)
[»] chr2 (13 HSPs)
chr2 (201-346)||(17375392-17375537)
chr2 (207-346)||(1895525-1895664)
chr2 (207-347)||(1551467-1551606)
chr2 (207-347)||(17281813-17281952)
chr2 (294-408)||(3921622-3921736)
chr2 (333-413)||(17375302-17375382)
chr2 (207-343)||(4869707-4869840)
chr2 (207-282)||(4140576-4140650)
chr2 (333-403)||(17281961-17282031)
chr2 (201-308)||(34660352-34660456)
chr2 (333-408)||(1895440-1895515)
chr2 (333-408)||(1551615-1551690)
chr2 (286-346)||(38531146-38531207)
[»] chr6 (4 HSPs)
chr6 (207-345)||(20740694-20740831)
chr6 (222-346)||(21881582-21881706)
chr6 (333-413)||(21881492-21881572)
chr6 (333-403)||(20740613-20740683)
[»] chr8 (4 HSPs)
chr8 (201-344)||(10408942-10409085)
chr8 (221-413)||(5994655-5994870)
chr8 (333-413)||(10408850-10408930)
chr8 (284-345)||(6444151-6444213)
[»] chr7 (2 HSPs)
chr7 (207-346)||(3302690-3302829)
chr7 (333-397)||(3302616-3302680)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 4e-79; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 200 - 413
Target Start/End: Complemental strand, 34655216 - 34655003
Alignment:
Q  200 agttgaaacgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttg 299  Q
    |||||| | |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||| |||    
T  34655216 agttgagatgttggttggtttcgtggtgtgtcgttggatgctttccggtgtttgtttggttttcgtgggtctcagactatttgatttgttttctcttttg 34655117  T
Q  300 gttgtggtggaggttgtgtttgctctcaacataggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgc 399  Q
    ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||| ||||||| |||||     
T  34655116 gttgtggtggaggttatgtttgctcgcaacataggtggtgatggatcatatctaggttcgcttatgaaatgttatggttttgatgcatctttgattgtgt 34655017  T
Q  400 tggtctgtgatgct 413  Q
    |||| |||| ||||    
T  34655016 tggtttgtggtgct 34655003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 222 - 413
Target Start/End: Original strand, 39708905 - 39709095
Alignment:
Q  222 gtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtggtggaggttgtgtttg 321  Q
    ||||||||| ||| |||||||| | ||| ||||||||||||| ||||||||  |||||||| || |||||||||||||||||||||||||||| ||||||    
T  39708905 gtggtgtgttgttagatgcttgtcggtggttgtttggttttc-tgggtctcgaactatttgattcgttttctctcttggttgtggtggaggttatgtttg 39709003  T
Q  322 ctctcaacataggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtgatgct 413  Q
    ||| ||| ||||||||||||||||| ||||| |||||||||| ||||| ||||| |||||||| ||||||||||||| |||| |||| ||||    
T  39709004 ctcgcaatataggtggtgatggatcgtatctgggttcgcttaggaactgttatggttttgatggatctttggttgtgttggtttgtggtgct 39709095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 207 - 346
Target Start/End: Complemental strand, 34118228 - 34118087
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggt--tgt 304  Q
    |||||||| |||||| ||||||||||||||||||||||| ||| |||||| |||||||||| ||||||| |||||| |||||||||||| |||||  |||    
T  34118228 acgttggtgggtttcatggtgtgtcgttggatgcttgccggtggttgtttagttttcgtggatctcagattatttgatttgttttctctattggttgtgt 34118129  T
Q  305 ggtggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    ||| |||||| ||||||||| |||||||||||||||||||||    
T  34118128 ggtagaggttatgtttgctcgcaacataggtggtgatggatc 34118087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 207 - 343
Target Start/End: Complemental strand, 615956 - 615823
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| |||||||||||||||||||||||||||  | ||| ||||||||||||  |||  ||   |||||||| || ||||||||||||||||||||    
T  615956 acgttggtgggtttcgtggtgtgtcgttggatgcttctcggtggttgtttggttttattggagct---actatttgattcgttttctctcttggttgtgg 615860  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatgg 343  Q
    ||||| || |||||| || ||||||||||||||||||    
T  615859 tggagattatgtttgatcgcaacataggtggtgatgg 615823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 34655392 - 34655326
Alignment:
Q  30 tatatttctatttatagattctcttaataatacttaaatatttacttaagaccaaatagattaactt 96  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  34655392 tatatttctatttatagattgtcttaataatacttaaatatttacttaagaccaaatagattaactt 34655326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 333 - 398
Target Start/End: Complemental strand, 34118077 - 34118012
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtg 398  Q
    ||||||||||||||||||||||||||||||||||||| ||||| |||   || |||||||||||||    
T  34118077 ggtggtgatggatcatatctaggttcgcttatgaactgttatggtttcagtggatctttggttgtg 34118012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 284 - 346
Target Start/End: Original strand, 11407929 - 11407992
Alignment:
Q  284 tttgttttctctcttggttgtgg-tggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    |||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||||||    
T  11407929 tttgttttctctcttggtggtgggtggaggttatgtttgctcgcaacataagtggtgatggatc 11407992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 287 - 413
Target Start/End: Original strand, 26236622 - 26236749
Alignment:
Q  287 gttttctctcttggttgtgg-tggaggttgtgtttgctctcaacataggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgt 385  Q
    ||||||||||| ||| |||| |||||||| ||||| |||  ||||||| ||||||||||||| |||| ||||| ||||||| || |||||  || ||||     
T  26236622 gttttctctctcggtggtggatggaggttatgtttactcgaaacatagatggtgatggatcagatctgggttcacttatgacctgttatgggttcgatgg 26236721  T
Q  386 atctttggttgtgctggtctgtgatgct 413  Q
    ||||||||||| | |||| |||| ||||    
T  26236722 atctttggttgcgttggtttgtggtgct 26236749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 111 - 146
Target Start/End: Complemental strand, 34655306 - 34655271
Alignment:
Q  111 tgttgtaaatgacaactttagagcaatgttatagta 146  Q
    ||||||||||||||||||||||||||||||||||||    
T  34655306 tgttgtaaatgacaactttagagcaatgttatagta 34655271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 110; Significance: 3e-55; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 207 - 408
Target Start/End: Original strand, 41355414 - 41355615
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| ||||| |||||||||||||||||||||||| ||| |||||| |||| ||||| ||| || ||||||| |||||||||||||||||||||||    
T  41355414 acgttggtgggttttgtggtgtgtcgttggatgcttgccggtggttgtttagtttccgtggatcttaggctatttgatttgttttctctcttggttgtgg 41355513  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctg 406  Q
    |||||||| | ||||||| ||||||||| |||||||||||||||||| ||||||| |||||||  |||| ||| |||| ||||||||||||| |||| ||    
T  41355514 tggaggttatatttgctcgcaacataggcggtgatggatcatatctatgttcgctcatgaacttatatggtttcgatggatctttggttgtgttggtttg 41355613  T
Q  407 tg 408  Q
    ||    
T  41355614 tg 41355615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 216 - 346
Target Start/End: Original strand, 7766882 - 7767012
Alignment:
Q  216 ggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtggtggaggttg 315  Q
    |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||     
T  7766882 ggtttcgtggtgtgtcgttggatgcttgccggtggttgtttggttttcgtgggtctcagactatttgatttgttttctctcttggttgtgatggaggtta 7766981  T
Q  316 tgtttgctctcaacataggtggtgatggatc 346  Q
    ||||||||| |||||||||||||||| ||||    
T  7766982 tgtttgctcgcaacataggtggtgattgatc 7767012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 207 - 346
Target Start/End: Original strand, 27169956 - 27170096
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttg-ttttctctcttggttgtg 305  Q
    |||||||| ||||||||||||||| | ||||||||| ||  || |||||||||||||||||||||||| ||||||| || | ||||||||||||||||||    
T  27169956 acgttggtgggtttcgtggtgtgttgctggatgctttccgatggttgtttggttttcgtgggtctcaggctatttgattcgtttttctctcttggttgtg 27170055  T
Q  306 gtggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    ||||||||| ||||||||| |||| || |||||||||||||    
T  27170056 gtggaggttatgtttgctcgcaacgtaagtggtgatggatc 27170096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 216 - 347
Target Start/End: Complemental strand, 18697180 - 18697047
Alignment:
Q  216 ggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggt--tgtggtggaggt 313  Q
    |||||||||||||||||||||||  ||| | ||| |||||||||||||||||||||||||||||||| |||||||| | | |||||  ||||||||||||    
T  18697180 ggtttcgtggtgtgtcgttggataattgtcggtggttgtttggttttcgtgggtctcagactatttgatttgttttttatattggttgtgtggtggaggt 18697081  T
Q  314 tgtgtttgctctcaacataggtggtgatggatca 347  Q
    | ||||||| | ||||||||||||||||||||||    
T  18697080 tatgtttgcccgcaacataggtggtgatggatca 18697047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 207 - 342
Target Start/End: Complemental strand, 7272025 - 7271893
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| |||||| |  |||||||||||||||||| ||||| ||||||||||||  |||| ||   |||||||| || ||||||||||||||||||||    
T  7272025 acgttggtgggtttctttatgtgtcgttggatgcttgtcagtggttgtttggttttattggggct---actatttgattcgttttctctcttggttgtgg 7271929  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatg 342  Q
    |||||||| ||||||||| |||||||||||||||||    
T  7271928 tggaggttatgtttgctcgcaacataggtggtgatg 7271893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 207 - 343
Target Start/End: Original strand, 6030258 - 6030391
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| |||||||||||||||||||||||||||  | ||| ||||||||||||  |||  ||   |||||||| || ||||||||||||||||| ||    
T  6030258 acgttggtgggtttcgtggtgtgtcgttggatgcttctcggtggttgtttggttttattggaact---actatttgattcgttttctctcttggttgcgg 6030354  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatgg 343  Q
    |||| ||| |||||| ||  |||||||||||||||||    
T  6030355 tggatgttatgtttgatcggaacataggtggtgatgg 6030391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 333 - 413
Target Start/End: Original strand, 7767022 - 7767102
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtgatgct 413  Q
    |||||||||||||||||||||||||| |||||||| | ||||| ||| |||| ||||||||||||| |||| |||| ||||    
T  7767022 ggtggtgatggatcatatctaggttcacttatgaattgttatggtttcgatggatctttggttgtgttggtttgtggtgct 7767102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 333 - 413
Target Start/End: Complemental strand, 18697038 - 18696958
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtgatgct 413  Q
    ||||||||||||||||||||||||||||||||||||| |||||  || | || ||||||||||||| |||| |||| ||||    
T  18697038 ggtggtgatggatcatatctaggttcgcttatgaactgttatgggttcggtggatctttggttgtgttggtttgtggtgct 18696958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 226 - 343
Target Start/End: Complemental strand, 26656941 - 26656827
Alignment:
Q  226 tgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtggtggaggttgtgtttgctct 325  Q
    |||||||||||||||||| | ||  ||||||| ||||  |||| ||   |||||||| || |||||||||||||||||| ||| ||||| |||||||||     
T  26656941 tgtgtcgttggatgcttgtcggttgttgtttgattttattggggct---actatttgattcgttttctctcttggttgttgtgaaggttatgtttgctcg 26656845  T
Q  326 caacataggtggtgatgg 343  Q
    ||| ||| ||||||||||    
T  26656844 caatataagtggtgatgg 26656827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 226 - 343
Target Start/End: Complemental strand, 26928528 - 26928414
Alignment:
Q  226 tgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtggtggaggttgtgtttgctct 325  Q
    |||||||||||||||||| | ||  ||||||| ||||  |||| ||   |||||||| || |||||||||||||||||| ||| ||||| |||||||||     
T  26928528 tgtgtcgttggatgcttgtcggttgttgtttgattttattggggct---actatttgattcgttttctctcttggttgttgtgaaggttatgtttgctcg 26928432  T
Q  326 caacataggtggtgatgg 343  Q
    ||| ||| ||||||||||    
T  26928431 caatataagtggtgatgg 26928414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 99; Significance: 1e-48; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 201 - 347
Target Start/End: Original strand, 23054096 - 23054242
Alignment:
Q  201 gttgaaacgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttgg 300  Q
    ||||| |||||||| ||||| |||| |||| | |||||||||| ||||| ||||||||||||||||||||| |||||||||| |||||||||||||||||    
T  23054096 gttgagacgttggtgggttttgtggcgtgttgctggatgcttgtcagtggttgtttggttttcgtgggtctgagactatttgatttgttttctctcttgg 23054195  T
Q  301 ttgtggtggaggttgtgtttgctctcaacataggtggtgatggatca 347  Q
    |||||||||||||| ||||||||| ||||||||||||||||||||||    
T  23054196 ttgtggtggaggttatgtttgctcgcaacataggtggtgatggatca 23054242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 207 - 340
Target Start/End: Complemental strand, 53202520 - 53202387
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| ||||| |||||||||||||||||||||| | ||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||    
T  53202520 acgttggtgggttttgtggtgtgtcgttggatgcttgtctgtggttgtttggttttcgtgggtctcaaactatttgatttgttttctctcttggttgtgg 53202421  T
Q  307 tggaggttgtgtttgctctcaacataggtggtga 340  Q
    |||||||| ||||||||| |||||||||||||||    
T  53202420 tggaggttatgtttgctcgcaacataggtggtga 53202387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 207 - 347
Target Start/End: Original strand, 47518319 - 47518459
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| | ||| |||||||||||||||||||||| | ||| ||||||||||||| |||||||||||||||||| ||||||||||||||  |||||||    
T  47518319 acgttggtagattttgtggtgtgtcgttggatgcttgtcggtggttgtttggttttcatgggtctcagactatttgatttgttttctctctatgttgtgg 47518418  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatggatca 347  Q
    |||||||| ||||||||| ||||||||||||||||||||||    
T  47518419 tggaggttatgtttgctcgcaacataggtggtgatggatca 47518459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 333 - 398
Target Start/End: Original strand, 47518468 - 47518533
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtg 398  Q
    |||||||||| ||||||||||||||||||||||||||  |||| ||| |||| |||||||||||||    
T  47518468 ggtggtgatgaatcatatctaggttcgcttatgaacttatatggtttcgatggatctttggttgtg 47518533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 333 - 397
Target Start/End: Complemental strand, 53202371 - 53202307
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgt 397  Q
    |||||||||| ||||||||||| ||||||||||||||  |||| ||| |||| ||||||||||||    
T  53202371 ggtggtgatgaatcatatctagattcgcttatgaacttatatggtttcgatggatctttggttgt 53202307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 289 - 346
Target Start/End: Complemental strand, 6410164 - 6410106
Alignment:
Q  289 tttctctcttggttgtgg-tggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    ||||||||||||| |||| |||||||| ||||||||| ||| |||||||||||||||||    
T  6410164 tttctctcttggtggtggatggaggttatgtttgctcgcaaaataggtggtgatggatc 6410106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 403
Target Start/End: Original strand, 23054258 - 23054320
Alignment:
Q  341 tggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggt 403  Q
    |||||||||||| |||||||||||||||| ||||| |||  ||| ||||||||||||| ||||    
T  23054258 tggatcatatctcggttcgcttatgaactgttatggtttcaatggatctttggttgtgttggt 23054320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 284 - 342
Target Start/End: Original strand, 24957550 - 24957609
Alignment:
Q  284 tttgttttctctcttggttgtgg-tggaggttgtgtttgctctcaacataggtggtgatg 342  Q
    |||||||||| ||||||  |||| |||||||| ||||||||| |||||||||||||||||    
T  24957550 tttgttttctttcttggaggtgggtggaggttatgtttgctcgcaacataggtggtgatg 24957609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 332 - 413
Target Start/End: Complemental strand, 6410097 - 6410016
Alignment:
Q  332 aggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtgatgct 413  Q
    |||||| ||| ||||| ||||  |||||||||||| |||||||| ||| |||| ||||| ||||||| |||| |||| ||||    
T  6410097 aggtggcgatcgatcagatctgagttcgcttatgatctattatggtttcgatgaatcttgggttgtgttggtttgtggtgct 6410016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 94; Significance: 9e-46; HSPs: 13)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 201 - 346
Target Start/End: Complemental strand, 17375537 - 17375392
Alignment:
Q  201 gttgaaacgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttgg 300  Q
    ||||| |||||||| ||||||||||||||||||||||||| || | ||| ||||||||||||||||| ||||| |||||||| || ||||||||| ||||    
T  17375537 gttgagacgttggtgggtttcgtggtgtgtcgttggatgcctgtcggtggttgtttggttttcgtggctctcacactatttgattcgttttctctattgg 17375438  T
Q  301 ttgtggtggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    |||||||||||||| ||||||||| |||||||||||||||||||||    
T  17375437 ttgtggtggaggttatgtttgctcacaacataggtggtgatggatc 17375392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 207 - 346
Target Start/End: Complemental strand, 1895664 - 1895525
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| | ||| |||||||||||||||||||||| | ||| |||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||    
T  1895664 acgttggtggattttgtggtgtgtcgttggatgcttgtcggtggttgtttggtttttgtgggtctcagactatttgatttcttttctctcttggttgtgg 1895565  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    |||||||| ||| ||||| |||||||||||||||| ||||    
T  1895564 tggaggttatgtctgctcgcaacataggtggtgattgatc 1895525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 207 - 347
Target Start/End: Original strand, 1551467 - 1551606
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| ||||| ||||  |||||||||||||||||| ||  ||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||    
T  1551467 acgttggtgggttttgtgga-tgtcgttggatgcttgcctgtaattgtttgattttcgtgggtctcagactatttgatttgttttctctattggttgtgg 1551565  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatggatca 347  Q
    |||| ||| ||||||||| ||||||||||||||||||||||    
T  1551566 tggatgttatgtttgctcgcaacataggtggtgatggatca 1551606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 207 - 347
Target Start/End: Original strand, 17281813 - 17281952
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| ||||| ||||||| |||||| |||||| || ||| ||||||| ||||||| |||||||||||||||| |||||||||||||||||| ||||    
T  17281813 acgttggtgggttttgtggtgtatcgttg-atgctttccggtggttgtttgtttttcgtaggtctcagactatttgatttgttttctctcttggtagtgg 17281911  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatggatca 347  Q
    |||||||| ||||||||| ||||||||||||||||||||||    
T  17281912 tggaggttatgtttgctcgcaacataggtggtgatggatca 17281952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 294 - 408
Target Start/End: Complemental strand, 3921736 - 3921622
Alignment:
Q  294 ctcttggttgtggtggaggttgtgtttgctctcaacataggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttgg 393  Q
    ||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||  |||| |||||||| || |||||    
T  3921736 ctcttggttgtggtggatgttatgtttgctcgcaacataggtggtgatggatcatatctaagttcgcttatgaacttatatggttttgatggatgtttgg 3921637  T
Q  394 ttgtgctggtctgtg 408  Q
    ||||| |||| ||||    
T  3921636 ttgtgttggtttgtg 3921622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 333 - 413
Target Start/End: Complemental strand, 17375382 - 17375302
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtgatgct 413  Q
    ||||||||||||||||||||||||||||||||||||| ||||| ||| |||| ||||||||||||| |||| |||| ||||    
T  17375382 ggtggtgatggatcatatctaggttcgcttatgaactgttatggtttcgatgaatctttggttgtgttggtttgtggtgct 17375302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 207 - 343
Target Start/End: Complemental strand, 4869840 - 4869707
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    ||||||||  ||||||||||||| ||||||||||||  | ||| ||||||||||||   ||| ||   |||||||| || ||||||||||||||||| ||    
T  4869840 acgttggtgcgtttcgtggtgtgacgttggatgcttctcggtggttgtttggttttaccggggct---actatttgattcgttttctctcttggttgcgg 4869744  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatgg 343  Q
    ||||||||  ||||| |  ||||||||||||||||||    
T  4869743 tggaggttacgtttgatagcaacataggtggtgatgg 4869707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 207 - 282
Target Start/End: Complemental strand, 4140650 - 4140576
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttg 282  Q
    |||||||| ||||| ||||||| |||||| ||||||||| ||| || |||||||||||||||||||||||||||||    
T  4140650 acgttggtgggttttgtggtgtatcgttg-atgcttgccggtggttctttggttttcgtgggtctcagactatttg 4140576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 333 - 403
Target Start/End: Original strand, 17281961 - 17282031
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggt 403  Q
    ||||||||||||||||||||||||| |||||||||||  |||| ||| |||| ||||||||||||| ||||    
T  17281961 ggtggtgatggatcatatctaggtttgcttatgaacttatatggtttcgatggatctttggttgtgttggt 17282031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 201 - 308
Target Start/End: Complemental strand, 34660456 - 34660352
Alignment:
Q  201 gttgaaacgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttgg 300  Q
    |||| ||||||||| ||||||||| |||||||||||||||||| | ||| ||||||||||||  | || ||   |||||||| || |||||||||||| |    
T  34660456 gttggaacgttggtgggtttcgtgatgtgtcgttggatgcttgtcggtggttgtttggttttattagggct---actatttgattcgttttctctcttag 34660360  T
Q  301 ttgtggtg 308  Q
    ||||||||    
T  34660359 ttgtggtg 34660352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 333 - 408
Target Start/End: Complemental strand, 1895515 - 1895440
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtg 408  Q
    ||||||||||  |||||||||||||||||||||||||  |||| ||| |||| ||||||||||||| |||| ||||    
T  1895515 ggtggtgatgagtcatatctaggttcgcttatgaacttatatggtttcgatggatctttggttgtgttggtttgtg 1895440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 333 - 408
Target Start/End: Original strand, 1551615 - 1551690
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtg 408  Q
    |||||||||||||||| | ||||||||||||||||||  |||  ||| |||| ||||||||||||| |||| ||||    
T  1551615 ggtggtgatggatcatgtataggttcgcttatgaacttatatagtttcgatggatctttggttgtgttggtttgtg 1551690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 346
Target Start/End: Original strand, 38531146 - 38531207
Alignment:
Q  286 tgttttctctcttggttgtgg-tggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    |||||||| ||||||| |||| |||||||| |||||| || ||||||| |||||||||||||    
T  38531146 tgttttctttcttggtggtggatggaggttttgtttgttcgcaacatatgtggtgatggatc 38531207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 87; Significance: 1e-41; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 207 - 345
Target Start/End: Complemental strand, 20740831 - 20740694
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||||| ||||| |||| ||||||||||||||||||  ||  ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||    
T  20740831 acgttggtgggttttgtgg-gtgtcgttggatgcttgcatgttattgtttggttttcgtgggtctcaaactatttgatttgttttctctcttggttgtgg 20740733  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatggat 345  Q
    |||| ||| ||||||||| ||||||||||||||||||||    
T  20740732 tggatgttatgtttgctcgcaacataggtggtgatggat 20740694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 346
Target Start/End: Complemental strand, 21881706 - 21881582
Alignment:
Q  222 gtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtggtggaggttgtgtttg 321  Q
    |||||||||||||||||||||| | ||  ||||||||||||||||| |||||||||||||| || |||||||||||||| ||||| ||||||| ||||||    
T  21881706 gtggtgtgtcgttggatgcttgtcggtcgttgtttggttttcgtggctctcagactatttgattcgttttctctcttggctgtggcggaggttatgtttg 21881607  T
Q  322 ctctcaacataggtggtgatggatc 346  Q
    ||| ||||| |||||||||||||||    
T  21881606 ctcgcaacaaaggtggtgatggatc 21881582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 333 - 413
Target Start/End: Complemental strand, 21881572 - 21881492
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtgatgct 413  Q
    |||||||||||||||||||||||||||||||||||||  |||| ||| |||| |||||||||| || |||| |||| ||||    
T  21881572 ggtggtgatggatcatatctaggttcgcttatgaactgctatggtttcgatgaatctttggttatgttggtttgtggtgct 21881492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 333 - 403
Target Start/End: Complemental strand, 20740683 - 20740613
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggt 403  Q
    ||||||||||||||||||||||||||| |||||||||  |||| ||| |||| ||||||||||||| ||||    
T  20740683 ggtggtgatggatcatatctaggttcggttatgaacttatatggtttcgatggatctttggttgtgttggt 20740613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 201 - 344
Target Start/End: Complemental strand, 10409085 - 10408942
Alignment:
Q  201 gttgaaacgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttgg 300  Q
    ||||| || ||||| ||||| ||||||||||||||||||||||   ||| || ||||||||| |||||||||| |||||||| ||| || ||||||||||    
T  10409085 gttgagacattggtgggttttgtggtgtgtcgttggatgcttgttggtggttatttggtttttgtgggtctcaaactatttgattttttctctctcttgg 10408986  T
Q  301 ttgtggtggaggttgtgtttgctctcaacataggtggtgatgga 344  Q
    |||||||||||||| ||||||||| |||||||||||||||||||    
T  10408985 ttgtggtggaggttatgtttgctcgcaacataggtggtgatgga 10408942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 221 - 413
Target Start/End: Complemental strand, 5994870 - 5994655
Alignment:
Q  221 cgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg-tggaggttgtgtt 319  Q
    |||||||||| |||||||| ||||| ||| |||||||||||||||||| |||| ||| |||| ||||||||||||||||||||||| |||| ||| ||||    
T  5994870 cgtggtgtgttgttggatggttgccggtgattgtttggttttcgtgggcctcaaactgtttgatttgttttctctcttggttgtggatggatgttatgtt 5994771  T
Q  320 tgctctcaacata----------------------ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgt 397  Q
    ||||| |||||||                      |||||||||||||||||||| |||||||||||||||| ||||| |||||||| ||||||||||||    
T  5994770 tgctcgcaacatagtgctaatggatcgatcatgatggtggtgatggatcatatctgggttcgcttatgaactgttatggttttgatggatctttggttgt 5994671  T
Q  398 gctggtctgtgatgct 413  Q
    | |||| |||| ||||    
T  5994670 gttggtttgtggtgct 5994655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 333 - 413
Target Start/End: Complemental strand, 10408930 - 10408850
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgtgctggtctgtgatgct 413  Q
    ||||||||||||||||||||||||||||||||||  | ||||| ||| |||| ||||||||||||| |||| |||| ||||    
T  10408930 ggtggtgatggatcatatctaggttcgcttatgatatgttatggtttcgatgaatctttggttgtgttggtttgtggtgct 10408850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 284 - 345
Target Start/End: Complemental strand, 6444213 - 6444151
Alignment:
Q  284 tttgttttctctcttggttgtgg-tggaggttgtgtttgctctcaacataggtggtgatggat 345  Q
    |||| |||||||||||||||||| |||||||| ||||||||| |||| |||||||| ||||||    
T  6444213 tttgatttctctcttggttgtggatggaggttatgtttgctcgcaacttaggtggttatggat 6444151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 207 - 346
Target Start/End: Complemental strand, 3302829 - 3302690
Alignment:
Q  207 acgttggttggtttcgtggtgtgtcgttggatgcttgccagtgtttgtttggttttcgtgggtctcagactatttgttttgttttctctcttggttgtgg 306  Q
    |||||| | |||||||||||||||| ||||||||||    ||| ||||||||||||||||| |||||||||||||| ||  ||| |||||||||||||||    
T  3302829 acgttgctgggtttcgtggtgtgtcattggatgcttagtggtggttgtttggttttcgtggatctcagactatttgattcatttcctctcttggttgtgg 3302730  T
Q  307 tggaggttgtgtttgctctcaacataggtggtgatggatc 346  Q
    |||||||| ||||||||| |||||||||||||||| ||||    
T  3302729 tggaggttatgtttgctcgcaacataggtggtgatagatc 3302690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 333 - 397
Target Start/End: Complemental strand, 3302680 - 3302616
Alignment:
Q  333 ggtggtgatggatcatatctaggttcgcttatgaactattatgattttgatgtatctttggttgt 397  Q
    |||||||||  ||||||||||| ||||||||| |||| ||||  ||| |||| ||||||||||||    
T  3302680 ggtggtgatacatcatatctagattcgcttattaactgttatagtttcgatggatctttggttgt 3302616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University