View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1741-Insertion-2 (Length: 122)

Name: NF1741-Insertion-2
Description: NF1741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1741-Insertion-2
NF1741-Insertion-2
[»] chr6 (2 HSPs)
chr6 (31-118)||(2928489-2928576)
chr6 (77-118)||(3002732-3002773)
[»] chr8 (1 HSPs)
chr8 (70-110)||(37200252-37200292)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 8e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 8e-31
Query Start/End: Original strand, 31 - 118
Target Start/End: Original strand, 2928489 - 2928576
Alignment:
Q  31 caactagtctgtcaatctctggtgtactgtttcggcagtttttcagtttcttagatttgtgtattggagctgttctattgcgtttttc 118  Q
    |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||  |||||||    
T  2928489 caactagtctgtcaatctctggtgtactgtttgggcggtttttcagtttcttagatttgtgtattggagttgttctattttgtttttc 2928576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 77 - 118
Target Start/End: Complemental strand, 3002773 - 3002732
Alignment:
Q  77 tttcttagatttgtgtattggagctgttctattgcgtttttc 118  Q
    ||||||| ||||||||||||||||||||||||||||||||||    
T  3002773 tttcttatatttgtgtattggagctgttctattgcgtttttc 3002732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 70 - 110
Target Start/End: Complemental strand, 37200292 - 37200252
Alignment:
Q  70 ttttcagtttcttagatttgtgtattggagctgttctattg 110  Q
    ||||||||||||||| |||||||||||| |||| |||||||    
T  37200292 ttttcagtttcttagttttgtgtattggggctgctctattg 37200252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University