View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_low_179 (Length: 206)

Name: NF1740_low_179
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_low_179
NF1740_low_179
[»] chr2 (2 HSPs)
chr2 (17-196)||(36770998-36771174)
chr2 (112-167)||(36783564-36783619)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 36771174 - 36770998
Alignment:
Q  17 catatactataatacagtattctctattattattatattcacaaccataggaaaattttgtgctcacttgatctttttaactaatcactgaccaatgacc 116  Q
    |||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  36771174 catatactataatacagtattctctattattat---attcacaaccataggaaaattttgtgctcacttgatcttattaactaatcactgaccaatgacc 36771078  T
Q  117 atgtatttagtataataaacgtcattgtcaacaattgaattatttcactttttaggattccagcaaaccctatgcttctc 196  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  36771077 atgtatttagtataataaacatcattgtcaacaattgaattatttcactttttaggattccagcaaaccctatgtttctc 36770998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 112 - 167
Target Start/End: Complemental strand, 36783619 - 36783564
Alignment:
Q  112 tgaccatgtatttagtataataaacgtcattgtcaacaattgaattatttcacttt 167  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||| |||| |||||    
T  36783619 tgaccatgtatttagcataataaacatcattgtcaacaattgaatcatttaacttt 36783564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University