View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_low_178 (Length: 209)

Name: NF1740_low_178
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_low_178
NF1740_low_178
[»] chr3 (1 HSPs)
chr3 (16-197)||(50505110-50505291)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 50505291 - 50505110
Alignment:
Q  16 ctttgtaccagatctttggtttttatatgcatggttttgactaatttttctcgttctccagcttccacggttggagcatgaattgttacattgagagttg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  50505291 ctttgtaccagatctttggtttttatatgcatggttttgactaatttttctcgttctccagcttccacggttggagcatgaattgttactttgagagttg 50505192  T
Q  116 catgctttatgtattgaatgtgcacgtaccaaaatgactaccagttacgttctcagcaagtagtgtcgtatgatattcttcg 197  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  50505191 catgctttatgtattgaatgtgcatgtaccaaaatgactaccagttacgttctcagcaagtagtgtcgtatgatatttttcg 50505110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University