View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_low_174 (Length: 215)

Name: NF1740_low_174
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_low_174
NF1740_low_174
[»] chr7 (2 HSPs)
chr7 (18-202)||(43396962-43397146)
chr7 (97-145)||(3499398-3499446)
[»] chr5 (1 HSPs)
chr5 (40-83)||(40086943-40086986)
[»] chr1 (1 HSPs)
chr1 (164-192)||(6495524-6495552)


Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 43396962 - 43397146
Alignment:
Q  18 aaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaaccaattttgaggtggatgagctagtggaggaaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  43396962 aaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaattttttaatgaaaccaattttgaggtggatgagctagtggaggaaat 43397061  T
Q  118 caaggttatgtcttggcggtggttgttgcatcatacgaagattccggtttgcctttactacgaatggtgttggaatccctatgct 202  Q
    |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43397062 caaggttatgtcttggcggtggttgttgcatggtacgaagattccggtttgcctttactacgaatggtgttggaatccctatgct 43397146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 145
Target Start/End: Complemental strand, 3499446 - 3499398
Alignment:
Q  97 ggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttg 145  Q
    ||||||||||||| |||| |||||||| ||||||||| ||| |||||||    
T  3499446 ggatgagctagtgaaggagatcaaggtgatgtcttggaggtcgttgttg 3499398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 83
Target Start/End: Original strand, 40086943 - 40086986
Alignment:
Q  40 ttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaa 83  Q
    |||||| |||||||||||||| |||| |||||||||||||||||    
T  40086943 ttgggtattgtggaaagctaggaatgataaaatttttaatgaaa 40086986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 192
Target Start/End: Original strand, 6495524 - 6495552
Alignment:
Q  164 gtttgcctttactacgaatggtgttggaa 192  Q
    |||||||||||||||||||||||||||||    
T  6495524 gtttgcctttactacgaatggtgttggaa 6495552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University