View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_low_142 (Length: 250)

Name: NF1740_low_142
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_low_142
NF1740_low_142
[»] chr2 (2 HSPs)
chr2 (1-113)||(38521563-38521675)
chr2 (182-243)||(38521433-38521494)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 38521675 - 38521563
Alignment:
Q  1 ttgtagctcttgatttttggtaattttgttctgattatgttcccatgatttgttttgattatgtttttgtgtcccctttagtaatttcatgttgttcctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38521675 ttgtagctcttgatttttggtaattttgttctgattatgttcccatgatttgttttgattatgtttttgtgtcccctttagtaatttcatgttgttcctg 38521576  T
Q  101 ccgacacatatta 113  Q
    |||||||||||||    
T  38521575 ccgacacatatta 38521563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 38521494 - 38521433
Alignment:
Q  182 attccctactcagtttgtgcactcttttcctaaaattatgcatgactgagtgtgatgatgtc 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38521494 attccctactcagtttgtgcactcttttcctaaaattatgcatgactgagtgtgatgatgtc 38521433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University