View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_low_119 (Length: 279)

Name: NF1740_low_119
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_low_119
NF1740_low_119
[»] chr3 (7 HSPs)
chr3 (18-269)||(24757382-24757633)
chr3 (18-269)||(24766379-24766630)
chr3 (31-187)||(24995799-24995955)
chr3 (31-185)||(23682754-23682908)
chr3 (31-185)||(24054991-24055145)
chr3 (52-165)||(23681586-23681699)
chr3 (52-165)||(24053823-24053936)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 24757633 - 24757382
Alignment:
Q  18 cagatctcaatctgtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca 117  Q
    |||||||  |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24757633 cagatctagatctgtttgtgatgacaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca 24757534  T
Q  118 cgaacttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgnnnnnnngctggaatgagaaagagctag 217  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||    
T  24757533 cgatcttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgtttttttgctggaatgagaaagagctag 24757434  T
Q  218 ttaaacctagatatttcgttttgtgttgcctttataagttctaattcctttg 269  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  24757433 ttaaacctagatatttcgttttgtgttgcctttataagttctaattactttg 24757382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 24766630 - 24766379
Alignment:
Q  18 cagatctcaatctgtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca 117  Q
    |||||||  |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24766630 cagatctagatctgtttgtgatgacaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca 24766531  T
Q  118 cgaacttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgnnnnnnngctggaatgagaaagagctag 217  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||    
T  24766530 cgatcttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgtttttttgctggaatgagaaagagctag 24766431  T
Q  218 ttaaacctagatatttcgttttgtgttgcctttataagttctaattcctttg 269  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  24766430 ttaaacctagatatttcgttttgtgttgcctttataagttctaattactttg 24766379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 31 - 187
Target Start/End: Original strand, 24995799 - 24995955
Alignment:
Q  31 gtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctc 130  Q
    |||||||||| | ||||||||||||||||||||||||||||||| ||||  ||||||  |||| || |||||| |||||| ||||||||| |||||||||    
T  24995799 gtttgtgatgtcgaatgatccatttaagcacatgtggtatgcacgtggagtggatggtgctcctggcccagattcaaatgccttccacgatcttgggctc 24995898  T
Q  131 tttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggc 187  Q
    ||||||||||||||||||| |||||||| ||||||| | | ||||||||||||||||    
T  24995899 tttggtgatggatttgatgtcgtttttgaaattgccctgcgaaactataacctaggc 24995955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 31 - 185
Target Start/End: Original strand, 23682754 - 23682908
Alignment:
Q  31 gtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctc 130  Q
    ||||| |||||| |||||||  |||||||||||||||||||||| ||||| ||||||  |||  |||||||||||||||||||||| ||| |||||||||    
T  23682754 gtttgagatggcgaatgatcattttaagcacatgtggtatgcacgtggattggatggtgctcttggaccagatccaaatgtcttccgcgaccttgggctc 23682853  T
Q  131 tttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctag 185  Q
     ||||||||||||||||||| ||||||||| ||||| ||  |||||| |||||||    
T  23682854 attggtgatggatttgatgctgtttttgcagttgccctagcaaactacaacctag 23682908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 31 - 185
Target Start/End: Original strand, 24054991 - 24055145
Alignment:
Q  31 gtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctc 130  Q
    ||||| |||||| |||||||  |||||||||||||||||||||| ||||| ||||||  |||  |||||||||||||||||||||| ||| |||||||||    
T  24054991 gtttgagatggcgaatgatcattttaagcacatgtggtatgcacgtggattggatggtgctcttggaccagatccaaatgtcttccgcgaccttgggctc 24055090  T
Q  131 tttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctag 185  Q
     ||||||||||||||||||| ||||||||| ||||| ||  |||||| |||||||    
T  24055091 attggtgatggatttgatgctgtttttgcagttgccctagcaaactacaacctag 24055145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 52 - 165
Target Start/End: Original strand, 23681586 - 23681699
Alignment:
Q  52 atttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctctttggtgatggatttgatgcc 151  Q
    ||||||| ||||||||| ||||| ||||| | ||||  |||| ||||||||| || |||||||||||||  |||||||  |||||||||||||||||||     
T  23681586 atttaagaacatgtggtttgcacttggattgaatggtgctcctggaccagattcagatgtcttccacgactttgggctaattggtgatggatttgatgcg 23681685  T
Q  152 gtttttgcaattgc 165  Q
    ||||||||| ||||    
T  23681686 gtttttgcagttgc 23681699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 52 - 165
Target Start/End: Original strand, 24053823 - 24053936
Alignment:
Q  52 atttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctctttggtgatggatttgatgcc 151  Q
    ||||||| ||||||||| ||||| ||||| | ||||  |||| ||||||||| || |||||||||||||  |||||||  |||||||||||||||||||     
T  24053823 atttaagaacatgtggtttgcacttggattgaatggtgctcctggaccagattcagatgtcttccacgactttgggctaattggtgatggatttgatgcg 24053922  T
Q  152 gtttttgcaattgc 165  Q
    ||||||||| ||||    
T  24053923 gtttttgcagttgc 24053936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University