View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_high_80 (Length: 342)

Name: NF1740_high_80
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_high_80
NF1740_high_80
[»] chr7 (2 HSPs)
chr7 (59-199)||(27474316-27474456)
chr7 (251-323)||(27474192-27474264)
[»] chr4 (1 HSPs)
chr4 (264-310)||(1178686-1178732)


Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 59 - 199
Target Start/End: Complemental strand, 27474456 - 27474316
Alignment:
Q  59 cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27474456 cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa 27474357  T
Q  159 atatcgatgcatggtgcgcaacagtttaactaacatctcag 199  Q
    ||||||||||||||||||||| |||||||||||||||||||    
T  27474356 atatcgatgcatggtgcgcaaaagtttaactaacatctcag 27474316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 251 - 323
Target Start/End: Complemental strand, 27474264 - 27474192
Alignment:
Q  251 gattgtaacagagagtttctccaattcgaacgcttagagagaaagaacatgaaaagattatcaacgaagccac 323  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27474264 gattgtaacagagagtttctccgattcgaacgcttagagagaaagaacatgaaaagattatcaacgaagccac 27474192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 310
Target Start/End: Original strand, 1178686 - 1178732
Alignment:
Q  264 agtttctccaattcgaacgcttagagagaaagaacatgaaaagatta 310  Q
    ||||||||| |||||||| |||||||| || ||||||||||||||||    
T  1178686 agtttctccgattcgaacacttagagaaaacgaacatgaaaagatta 1178732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University