View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1740_high_123 (Length: 262)

Name: NF1740_high_123
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1740_high_123
NF1740_high_123
[»] chr3 (1 HSPs)
chr3 (68-215)||(47350604-47350751)


Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 68 - 215
Target Start/End: Complemental strand, 47350751 - 47350604
Alignment:
Q  68 agctgagaatgaaaggcattttcattggagctgggattcatgagctacgcttagctgaagttagtatgatggctcttgaagaaaccactctcttccaaca 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47350751 agctgagaatgaaaggcattttcattggagctgggattcatgagctacgcttagctgaagttagtatgatggctcttgaagaaaccactctcttccaaca 47350652  T
Q  168 ttgttttagttgaaggtcacagtttgttcattttttaacgtcccatta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  47350651 ttgttttagttgaaggtcacagtttgttcattttttaacgtcccatta 47350604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University