View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17408_high_61 (Length: 248)

Name: NF17408_high_61
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17408_high_61
NF17408_high_61
[»] chr8 (2 HSPs)
chr8 (19-236)||(12945502-12945719)
chr8 (17-128)||(12937938-12938049)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 12945719 - 12945502
Alignment:
Q  19 aaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggtttcatcctct 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12945719 aaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggtttcatcctct 12945620  T
Q  119 accacccttcctcgctcattttccaccatccctgctctacattagctgctcaaattcctgccattgttgcctcggttgattatcgtctctcgcctgagca 218  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  12945619 accacccttcctcgctcattttccaccacccctgctctacattagctgctcaaattcctgccattgttgcctccgttgattatcgtctctcgcctgagca 12945520  T
Q  219 tcgcctcccagcagccta 236  Q
    ||||||||||||||||||    
T  12945519 tcgcctcccagcagccta 12945502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 12938049 - 12937938
Alignment:
Q  17 caaaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggtttcatcct 116  Q
    |||| |||||||| ||  |||||||||| |||||||||||  |||| || || || || |||||  | ||||||||||||||||||||||||||| |||     
T  12938049 caaacacctccatccgcatcttcctcccaaaccctccaccaccttcttccgcggctaagctccctctcattctctacttccatggtggtggtttcttccg 12937950  T
Q  117 ctaccacccttc 128  Q
    |||||| |||||    
T  12937949 ctaccatccttc 12937938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University