View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17405_high_5 (Length: 218)

Name: NF17405_high_5
Description: NF17405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17405_high_5
NF17405_high_5
[»] chr5 (1 HSPs)
chr5 (1-205)||(35641-35845)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 35641 - 35845
Alignment:
Q  1 ctttcattcagtttttatatgtattttgtaaggaccttcatacttggataacaacccatatgatatacacctaggatataaagttgttaattataacctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35641 ctttcattcagtttttatatgtattttgtaaggaccttcatacttggataacaacccatatgatatacacctaggatataaagttgttaattataacctt 35740  T
Q  101 ttatcacttgattgaaatcacttgtccctttttgtctcctttcatgtctattcttttgaaaaatgacaatttgtcacattgttttcaaactcgtatgttc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  35741 ttatcacttgattgaaatcacttgtccctttttgtctcctttcatgtctattcttttgaaaaatgacaatttgtgacattgttttcaaactcgtatgttc 35840  T
Q  201 atctc 205  Q
    |||||    
T  35841 atctc 35845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University