View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17402_high_43 (Length: 306)

Name: NF17402_high_43
Description: NF17402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17402_high_43
NF17402_high_43
[»] chr6 (2 HSPs)
chr6 (123-226)||(31788511-31788613)
chr6 (239-289)||(31788381-31788431)


Alignment Details
Target: chr6 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 123 - 226
Target Start/End: Complemental strand, 31788613 - 31788511
Alignment:
Q  123 acttcacgttattttttgcttgtgaagaagaaattataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa 222  Q
    |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31788613 acttcacgttattttttgtttgtgaagaagaa-ttataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa 31788515  T
Q  223 ccca 226  Q
    ||||    
T  31788514 ccca 31788511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 239 - 289
Target Start/End: Original strand, 31788381 - 31788431
Alignment:
Q  239 aacctgtggtttgatcaactcaaactccatgatgttgttgatgatgtccat 289  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  31788381 aacctgtggtttgatcaactccaactccatgatgttgttgatgatgtccat 31788431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University