View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17402_high_18 (Length: 365)

Name: NF17402_high_18
Description: NF17402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17402_high_18
NF17402_high_18
[»] chr8 (1 HSPs)
chr8 (259-312)||(22552201-22552254)
[»] chr4 (1 HSPs)
chr4 (110-138)||(33962309-33962337)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 259 - 312
Target Start/End: Original strand, 22552201 - 22552254
Alignment:
Q  259 tccccttccaaccaccgcaacaaacgctgcagtcgcagtcgtaaccccaacgcc 312  Q
    ||||||||||||||||||||||||||  |  |||| ||||||||||||||||||    
T  22552201 tccccttccaaccaccgcaacaaacgtcgtcgtcgtagtcgtaaccccaacgcc 22552254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 110 - 138
Target Start/End: Original strand, 33962309 - 33962337
Alignment:
Q  110 aacaaatgctgcaatctcccccatttttt 138  Q
    |||||||||||||||||||||||||||||    
T  33962309 aacaaatgctgcaatctcccccatttttt 33962337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University