View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17401_high_18 (Length: 256)

Name: NF17401_high_18
Description: NF17401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17401_high_18
NF17401_high_18
[»] chr6 (2 HSPs)
chr6 (1-112)||(1025834-1025945)
chr6 (205-241)||(1025695-1025731)


Alignment Details
Target: chr6 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 1025945 - 1025834
Alignment:
Q  1 attatactcagcactatcttgccaccttaaatttatcgtagaaaattacactagacattcaaaagtgaataagactttcaaataaaaatatatttggata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1025945 attatactcagcactatcttgccaccttaaatttatcgtagaaaattacactagacattcaaaagtgaataagactttcaaataaaaatatatttggata 1025846  T
Q  101 catatacataga 112  Q
    ||||||||||||    
T  1025845 catatacataga 1025834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 1025731 - 1025695
Alignment:
Q  205 atttgaaagtgtgaccatcgaaaactttagtgaaaac 241  Q
    ||||||||||||||| |||||||||||||||||||||    
T  1025731 atttgaaagtgtgactatcgaaaactttagtgaaaac 1025695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University