View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1739_low_49 (Length: 307)

Name: NF1739_low_49
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1739_low_49
NF1739_low_49
[»] chr1 (2 HSPs)
chr1 (11-120)||(52191032-52191141)
chr1 (211-291)||(52191229-52191309)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 11 - 120
Target Start/End: Original strand, 52191032 - 52191141
Alignment:
Q  11 cagagagaaagaaagtaaaaatagagtaccattggggtttgtcagtgagattaatcaaatggatgttgtgtgggatcttcttctcttccaaagttaagag 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52191032 cagagagaaagaaagtaaaaatagagtaccattggggtttgtcagtgagattaatcaaatggatgttgtgtgggatcttcttctcttccaaagttaagag 52191131  T
Q  111 aaccctctgg 120  Q
    ||||||||||    
T  52191132 aaccctctgg 52191141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 52191229 - 52191309
Alignment:
Q  211 gcgtacagtctccgagaatagttggagcaccaacagcagccttgacagcaacctcaagagccatttgcgatgaaatcaatg 291  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52191229 gcgtacagtctccgagaatagttggagcaccaacagcagccttgacagcaacctcaagagccatttgcgatgaaatcaatg 52191309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University