View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1739_low_26 (Length: 412)

Name: NF1739_low_26
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1739_low_26
NF1739_low_26
[»] chr1 (1 HSPs)
chr1 (68-151)||(4776407-4776490)
[»] chr2 (1 HSPs)
chr2 (231-287)||(446926-446982)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 68 - 151
Target Start/End: Original strand, 4776407 - 4776490
Alignment:
Q  68 ctttgagggaaaattgatctgcaagtgcctgtttaaattgatctagaaaactagaatcgttgccgcatagtaataaatcatcaa 151  Q
    |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  4776407 ctttgagggaaaattgatctgcaagtgcctctttaaattgatctggaaaactagaatcgttgccgcatagtaataaatcatcaa 4776490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 231 - 287
Target Start/End: Original strand, 446926 - 446982
Alignment:
Q  231 gagagagcaatgccgagaacaatcttcattgtttgaggtttgatgacagggctaaag 287  Q
    ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||    
T  446926 gagagagcaatgcagagaacaatcttgattgtttgaggtttgatgacagggctaaag 446982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University