View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1739_low_105 (Length: 230)

Name: NF1739_low_105
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1739_low_105
NF1739_low_105
[»] chr6 (1 HSPs)
chr6 (64-230)||(34771857-34772023)


Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 34772023 - 34771857
Alignment:
Q  64 gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34772023 gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc 34771924  T
Q  164 acaagcaggtcatctcatgtctttccctttcataagctgaaacaaaataagattaacaaaattataa 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34771923 acaagcaggtcatctcatgtctttccctttcataagctgaaacaaaataagattaacaaaattataa 34771857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University