View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17392_low_6 (Length: 253)

Name: NF17392_low_6
Description: NF17392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17392_low_6
NF17392_low_6
[»] chr4 (1 HSPs)
chr4 (1-232)||(54607482-54607716)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 54607716 - 54607482
Alignment:
Q  1 tgtgggtccaatattagttatataacaggagaagagagggnnnnnnnn---cattggctttttctgctagggcttaatagcagcaacaaattaaccgaaa 97  Q
    |||||| ||||||||||||||||||||||||||||||| |           |||||||||||||||||||||||||| ||||||| ||||||||||||||    
T  54607716 tgtgggcccaatattagttatataacaggagaagagagagggaaaaaaaaacattggctttttctgctagggcttaacagcagcagcaaattaaccgaaa 54607617  T
Q  98 cccttcttcgattgagatgggagnnnnnnncagtatctagtctattgagtgcggcagtgtagggttttcggttcagattgagaggaaggaagaagatggc 197  Q
    |||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54607616 cccttcttcgattgagatgggagaaaaaaacagtatctagtctattgagtgcggcagtgtagggttttcggttcagattgagaggaaggaagaagatggc 54607517  T
Q  198 aaaaacaagtgttaatcgatatatggatatggact 232  Q
    ||||||||||||||| | |||||||||||||||||    
T  54607516 aaaaacaagtgttaaccaatatatggatatggact 54607482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University