View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17385_low_55 (Length: 245)

Name: NF17385_low_55
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17385_low_55
NF17385_low_55
[»] chr4 (3 HSPs)
chr4 (1-238)||(3548746-3548983)
chr4 (170-226)||(1829339-1829395)
chr4 (208-236)||(20950895-20950923)
[»] chr2 (1 HSPs)
chr2 (50-125)||(43812251-43812326)


Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 3548746 - 3548983
Alignment:
Q  1 tttagttcatcacattcttcttatatctgactcaacattgtctttgattaatagattatgacaacgcgacaacggactgatctccacatgaacatccctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3548746 tttagttcatcacattcttcttatatctgactcaacattgtctttgattaatagattatgacaacgcgacaacggactgatctccacatgaacatccctg 3548845  T
Q  101 ccttgagaaagcttgatgcaatgcttattgtaagatcacaaatcctgagttaaatatgatcattatatgttgggttaaatatgtttttagtcttgataat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3548846 ccttgagaaagcttgatgcaatgcttattgtaagatcacaaatcctgagttaaatatgatcattatatgttgggttaaatatgtttttagtcttgataat 3548945  T
Q  201 tatgccgaattttgtttttagtccctgcattcatttct 238  Q
    ||||||||||||||||||||||||||| ||||| ||||    
T  3548946 tatgccgaattttgtttttagtccctgtattcacttct 3548983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 1829395 - 1829339
Alignment:
Q  170 ttgggttaaatatgtttttagtcttgataattatgccgaattttgtttttagtccct 226  Q
    ||||||||||||||||||| ||||| |||| |||||| | ||||  |||||||||||    
T  1829395 ttgggttaaatatgtttttggtctttataaatatgccaactttttgttttagtccct 1829339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 208 - 236
Target Start/End: Complemental strand, 20950923 - 20950895
Alignment:
Q  208 aattttgtttttagtccctgcattcattt 236  Q
    |||||||||||||||||||||||||||||    
T  20950923 aattttgtttttagtccctgcattcattt 20950895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 50 - 125
Target Start/End: Complemental strand, 43812326 - 43812251
Alignment:
Q  50 aatagattatgacaacgcgacaacggactgatctccacatgaacatccctgccttgagaaagcttgatgcaatgct 125  Q
    |||||||||||||||| |||||||| || |||||||||||||| ||||| |||||  | ||||| |||||||||||    
T  43812326 aatagattatgacaacacgacaacgaacagatctccacatgaatatcccagccttacgcaagctcgatgcaatgct 43812251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University