View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17385_high_52 (Length: 248)

Name: NF17385_high_52
Description: NF17385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17385_high_52
NF17385_high_52
[»] chr5 (2 HSPs)
chr5 (110-212)||(13744612-13744713)
chr5 (14-89)||(13744710-13744785)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 13744713 - 13744612
Alignment:
Q  110 tttggttgaattccggtaatcatattaatttgctagtcctgcagttctatgcatactaaaactcaggtaccagttacctatgattagcatatttcataca 209  Q
    |||||||||||||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||| || |||||||||||||||||    
T  13744713 tttggttgaattccagtaatca-attaatttgctagtcctacatttctatgcatactaaaactcaggtaccagttacctttggttagcatatttcataca 13744615  T
Q  210 gct 212  Q
    |||    
T  13744614 gct 13744612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 13744785 - 13744710
Alignment:
Q  14 atcatctgtataatcatcaatgaaaatatcagaacccacatgagatgctaaggtggaaggaacacacaataatttg 89  Q
    ||||||| ||||||||||||| ||||||||||| ||||||  ||||||||||||||||||||||||||||||||||    
T  13744785 atcatctatataatcatcaataaaaatatcagatcccacaatagatgctaaggtggaaggaacacacaataatttg 13744710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University