View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17381_low_11 (Length: 233)

Name: NF17381_low_11
Description: NF17381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17381_low_11
NF17381_low_11
[»] chr8 (1 HSPs)
chr8 (15-219)||(7865719-7865923)


Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 7865923 - 7865719
Alignment:
Q  15 aatattcagagctacttcaaaaatcagctccaattggagctaaaattggttttgcaaaaggtgcaggaatgggtgttatctacttagtaacatattcaac 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7865923 aatattcagagctacttcaaaaatcagctccaattggagctaaaattggttttgcaaaaggtgcaggaatgggtgttatctacttagtaacatattcaac 7865824  T
Q  115 atgggctttggctttttggtatggctctatcttaattgctaggggtgaacttgatggtggttcagctattgcttgtttctttggtgtcaatgttggggga 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  7865823 atgggctttggctttttggtatggctctatcttaattgctaggggtgaacttgatggtggttcagctattgcttgtttcttcggtgtcaatgttggggga 7865724  T
Q  215 aggtg 219  Q
    |||||    
T  7865723 aggtg 7865719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University