View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17380_low_62 (Length: 245)

Name: NF17380_low_62
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17380_low_62
NF17380_low_62
[»] chr5 (1 HSPs)
chr5 (1-229)||(10478957-10479188)


Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 10479188 - 10478957
Alignment:
Q  1 aaatttcgtcataattttaagaagttttccacgaagggctgctgccttggtaaccttaatccactcataactacttaattatatggtgatgtttagtgtg 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10479188 aaatttcgtcataattttaagaagttttccacgaagggctgccgccttggtaaccttaatccactcataactacttaattatatggtgatgtttagtgtg 10479089  T
Q  101 caaagtgtagcatttgcttgaatatatgccattatgtttc---tattgctaagtgccgcataatttttggtatgagatggtatccttttttcagcattta 197  Q
    |||||||||||||||||||||||||||||||| |||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10479088 caaagtgtagcatttgcttgaatatatgccatgatgtttctattattgctaagtgccgcataatttttggtatgagatggtatccttttttcagcattta 10478989  T
Q  198 cttttgtttacttcattaacttttgcttgaat 229  Q
    ||||||||||||||||||||||||||||||||    
T  10478988 cttttgtttacttcattaacttttgcttgaat 10478957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University