View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17380_high_57 (Length: 245)

Name: NF17380_high_57
Description: NF17380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17380_high_57
NF17380_high_57
[»] chr7 (1 HSPs)
chr7 (103-226)||(37858804-37858927)


Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 103 - 226
Target Start/End: Complemental strand, 37858927 - 37858804
Alignment:
Q  103 tgtgttgagaaggtggaagatgagatgggtgtgactaagtttggaagaccaagaaggtgcaaagaaagtgggaatagagannnnnnnggtgatggatact 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||    
T  37858927 tgtgttgagaaggtggaagatgagatgggtgtgactaagtttggaagaccaagaaggtgcaaagaaagtgggaatagagatttttttggtgatggatact 37858828  T
Q  203 ttgagcttccatctctttcactat 226  Q
    ||||||||||||||||||||||||    
T  37858827 ttgagcttccatctctttcactat 37858804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University