View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17374_low_8 (Length: 270)

Name: NF17374_low_8
Description: NF17374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17374_low_8
NF17374_low_8
[»] scaffold0141 (1 HSPs)
scaffold0141 (161-256)||(6234-6329)
[»] chr1 (3 HSPs)
chr1 (141-256)||(49237921-49238036)
chr1 (1-95)||(44285603-44285697)
chr1 (1-95)||(44070316-44070410)


Alignment Details
Target: scaffold0141 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: scaffold0141
Description:

Target: scaffold0141; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 161 - 256
Target Start/End: Complemental strand, 6329 - 6234
Alignment:
Q  161 agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagat 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6329 agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagat 6234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 141 - 256
Target Start/End: Original strand, 49237921 - 49238036
Alignment:
Q  141 cagactgcctctttctagatagattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgc 240  Q
    |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |    
T  49237921 cagactgcctatttctagatagattctatggatgatgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccaatgcatgtcgtac 49238020  T
Q  241 cttgcaagattgagat 256  Q
    ||||||||||||||||    
T  49238021 cttgcaagattgagat 49238036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 44285697 - 44285603
Alignment:
Q  1 gaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaacttccggtaagaa 95  Q
    ||||||| || || |||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||    
T  44285697 gaaatgccgaatttgctccgcatcgttaggtaaagatccccattggccaatcttcctttaatggatatattcttcaatgtaacttccggtaagaa 44285603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 44070316 - 44070410
Alignment:
Q  1 gaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaacttccggtaagaa 95  Q
    ||||||| || |||||||||||   | ||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||    
T  44070316 gaaatgccgaattcgctccgcattgtaaggtaaagatctccattgtccaatcttgctttaatggatatattcttcaatgtaacttctggtaagaa 44070410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University