View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17373_low_24 (Length: 255)

Name: NF17373_low_24
Description: NF17373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17373_low_24
NF17373_low_24
[»] chr5 (1 HSPs)
chr5 (27-234)||(26562070-26562277)


Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 27 - 234
Target Start/End: Original strand, 26562070 - 26562277
Alignment:
Q  27 gagcttatgaaatgatcacatgcaaactgaaaataggaatacaaacattcattgaagtatttttgtttatacatgcctaggtgcctcgtccgtagcaagg 126  Q
    ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
T  26562070 gagctcatgaaatgatcacatgcaaactgaaaataggaaaacaaacattcattgaagtatttttgtttatacatgcatgggtgcctcgtccgtagcaagg 26562169  T
Q  127 cagtggttttggtgtccctgtggcacagcagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacaaaattgatgcaca 226  Q
      ||||||||||||||||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  26562170 tggtggttttggtgtccctatggcacgacagggcgacttgcttgagcttttgcacgacatgaatgaataaacggtccgtatacgacgaaattgatgcaca 26562269  T
Q  227 tcacatat 234  Q
    ||||||||    
T  26562270 tcacatat 26562277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University