View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17371_low_3 (Length: 280)

Name: NF17371_low_3
Description: NF17371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17371_low_3
NF17371_low_3
[»] chr2 (1 HSPs)
chr2 (9-264)||(37212692-37212947)


Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 9 - 264
Target Start/End: Original strand, 37212692 - 37212947
Alignment:
Q  9 gagaagaaggaagggaaaccatcggcagaggcggcggtggtttgaagctgatcggaaggtggaggcggcggtggtgaggctggtggacggtagattgaga 108  Q
    |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37212692 gagaagaaggaagggaaaccatcggcagagacggcggtggtttgaggctgatcggaaggtggaggcggcggtggtgaggctggtggacggtagattgaga 37212791  T
Q  109 tctgagagagggagttgagacggtgagatctggcggttatctttgagtcgcggaggcgagctagggttcctggtttcaggaatttgtggaagttgtttgg 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||    
T  37212792 tctgagagagggagttgagacggtgagatctggcggttatctttgagtcgcggaggcgagctagggttcctggtttgaggaatttgtggaagtggtttgg 37212891  T
Q  209 taaagtaggtcttgttctctgcttcatggtgatggaagaaagagagaattgggaga 264  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37212892 taaagtaggtcttgttctctgcttcatggtgatggaagaaagagagaattgggaga 37212947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University